Stem-loop sequence mmu-mir-138-1

Accession

MI0000722 (change log)

Symbol

MGI:Mir138-1

Description

Mus musculus miR-138-1 stem-loop

Gene family

MIPF0000075; mir-138

Literature search

94 open access papers mention mmu-mir-138-1
(728 sentences)

Stem-loop

   cucua   ug    u   -  a ag             uca       gc a 
5'      gca  gugu gug gg c  cugguguugugaa   ggccguu  c a
        |||  |||| ||| || |  |||||||||||||   |||||||  | u
3'      cgu  cacg cac cc g  gaccacaacacuu   ucggcaa  g c
   --gaa   --    u   a  - -g             -ca       ga a 

Deep sequencing

495183 reads, 775 reads per million, 103 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse miR-138 was cloned from mouse brain tissue in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2]. mir-138-1 (MI0000722) is found on mouse chromosome 8, and mir-138-2 (MI0000164, previously named mir-138 here) on chromosome 9. Kim et al. and Obernosterer et al. independently show that the mature product is a 23mer [3,4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr9: 122682876-122682974 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir138-1
• MGI:Mir138-1
• RNAcentral:URS000075E62C_10090
• miRBase Tracker:MI0000722

Mature sequence mmu-miR-138-5p

• Accession: MIMAT0000150
• Previous IDs: mmu-miR-138
• Sequence: 23 - agcugguguugugaaucaggccg - 45
• Deep sequencing: 980725 reads, 103 experiments
• Evidence: experimental; cloned [1,5], Illumina [6-7]
• Database links:
  • RNAcentral:URS000040780F_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-138-5p
  • miRDB:mmu-miR-138-5p
  • microrna.org:mmu-miR-138-5p

Mature sequence mmu-miR-138-1-3p

• Accession: MIMAT0004668
• Previous IDs: mmu-miR-138*;mmu-miR-138-1*
• Sequence: 61 - cggcuacuucacaacaccaggg - 82
• Deep sequencing: 4027 reads, 52 experiments
• Evidence: experimental; cloned [5], Illumina [6-7]
• Database links:
  • RNAcentral:URS00003980D0_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-138-1-3p
  • miRDB:mmu-miR-138-1-3p
  • microrna.org:mmu-miR-138-1-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
4. PMID:16738409 "Post-transcriptional regulation of microRNA expression" Obernosterer G, Leuschner PJ, Alenius M, Martinez J RNA. 12:1161-1167(2006).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).