![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-92a-1 |
||||||||||||||
Accession | MI0000719 (change log) | |||||||||||||
Previous IDs | mmu-mir-92-1 | |||||||||||||
Description | Mus musculus miR-92a-1 stem-loop | |||||||||||||
Gene family | MIPF0000013; mir-25 | |||||||||||||
Literature search |
![]()
139 open access papers mention mmu-mir-92a-1 | |||||||||||||
Stem-loop |
---cu uac uu c uuu 5' uuc acagguugggau gu gcaaugcugug c ||| |||||||||||| || ||||||||||| 3' gag uguccggcccug ca cguuaugguau u gguuu --u uu - guc |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
The predominant miR-92 form cloned by Landgraf et al. has a additional 3' U residue, which is compatible with this precursor sequence, but not with that of mir-92-2 (MI0000580) [4]. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence mmu-miR-92a-1-5p |
|
Accession | MIMAT0017066 |
Previous IDs | mmu-miR-92a-1* |
Sequence |
11 - agguugggauuugucgcaaugcu - 33 |
Deep sequencing | 23341 reads, 98 experiments |
Evidence | experimental; 454 [6], Illumina [7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-92a-3p |
|
Accession | MIMAT0000539 |
Previous IDs | mmu-miR-92;mmu-miR-92a |
Sequence |
50 - uauugcacuugucccggccug - 70 |
Deep sequencing | 10803467 reads, 107 experiments |
Evidence | experimental; cloned [1,3-4], Northern [1], Illumina [5,7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|