![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-124-2 |
||||||
Accession | MI0000717 (change log) | |||||
Previous IDs | mmu-mir-124a-2 | |||||
Symbol | MGI:Mir124a-2 | |||||
Description | Mus musculus miR-124-2 stem-loop | |||||
Gene family | MIPF0000021; mir-124 | |||||
Literature search |
![]()
227 open access papers mention mmu-mir-124-2 | |||||
Stem-loop |
a au ---- a cc a ga uaau 5' ucaag cag ag cucugcucu guguucac gcg ccuugauu g ||||| ||| || ||||||||| |||||||| ||| |||||||| u 3' aguuc guc uc gaggcgaga cguaagug cgc ggaauuaa c a ac ggca c ac g ac caua |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MI0000716) on chromosome 14, mir-124-2 (MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124 here, MI0000150) on chromosome 2. All have closely related predicted human homologues (MI0000443, MI0000444 and MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-124-5p |
|
Accession | MIMAT0004527 |
Previous IDs | mmu-miR-124* |
Sequence |
25 - cguguucacagcggaccuugau - 46 |
Deep sequencing | 8477 reads, 35 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-124-3p |
|
Accession | MIMAT0000134 |
Previous IDs | mmu-miR-124a;mmu-miR-124 |
Sequence |
62 - uaaggcacgcggugaaugcc - 81 |
Deep sequencing | 3529575 reads, 78 experiments |
Evidence | experimental; cloned [1-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|