Stem-loop sequence mmu-mir-124-1

AccessionMI0000716 (change log)
Previous IDsmmu-mir-124a-1
Symbol MGI:Mir124a-1
DescriptionMus musculus miR-124-1 stem-loop
Gene family MIPF0000021; mir-124
Literature search

229 open access papers mention mmu-mir-124-1
(2608 sentences)

Stem-loop
   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 
Get sequence
Deep sequencing
1179368 reads, 6.85e+03 reads per million, 81 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MI0000716) on chromosome 14, mir-124-2 (MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124 here, MI0000150) on chromosome 2. All have closely related predicted human homologues (MI0000443, MI0000444 and MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 64590657-64590741 [+]
sense
ENSMUST00000180610 ; A930011O12Rik-201; exon 2
ENSMUST00000181808 ; A930011O12Rik-202; exon 4
Clustered miRNAs
< 10kb from mmu-mir-124-1
mmu-mir-124-1chr14: 64590657-64590741 [+]
mmu-mir-3078chr14: 64591185-64591271 [+]
Database links

Mature sequence mmu-miR-124-5p

Accession MIMAT0004527
Previous IDsmmu-miR-124*
Sequence

14 - 

cguguucacagcggaccuugau

 - 35

Get sequence
Deep sequencing8477 reads, 35 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-124-3p

Accession MIMAT0000134
Previous IDsmmu-miR-124a;mmu-miR-124
Sequence

53 - 

uaaggcacgcggugaaugcc

 - 72

Get sequence
Deep sequencing3529575 reads, 78 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).