Stem-loop sequence mmu-mir-135a-2

Accession

MI0000715 (change log)

Previous IDs

mmu-mir-135-2

Symbol

MGI:Mir135a-2

Description

Mus musculus miR-135a-2 stem-loop

Gene family

MIPF0000028; mir-135

Literature search

74 open access papers mention mmu-mir-135a-2
(506 sentences)

Stem-loop

   a  uaaa     ucua   c            u            -u gua 
5'  ga    uucac    gug uuuauggcuuuu auuccuauguga  c   a
    ||    |||||    ||| |||||||||||| ||||||||||||  |    
3'  cu    aagug    cau aaguaccgaagg uagggauguacu  g   u
   a  -uaa     -uua   a            -            cu aaa 

Deep sequencing

186065 reads, 1.72e+03 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr10: 92072086-92072185 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000113031 ; Rmst-010; intron 2

  OTTMUST00000113029 ; Rmst-009; intron 4

  ENSMUST00000181977 ; Rmst-010; intron 2

  ENSMUST00000182440 ; Rmst-009; intron 4

Database links

• EntrezGene:Mir135a-2
• MGI:Mir135a-2
• RNAcentral:URS000075BBB8_10090
• miRBase Tracker:MI0000715

Mature sequence mmu-miR-135a-5p

• Accession: MIMAT0000147
• Previous IDs: mmu-miR-135a
• Sequence: 23 - uauggcuuuuuauuccuauguga - 45
• Deep sequencing: 365449 reads, 76 experiments
• Evidence: experimental; cloned [1,3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00000DF6D0_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-135a-5p
  • miRDB:mmu-miR-135a-5p
  • microrna.org:mmu-miR-135a-5p

Mature sequence mmu-miR-135a-2-3p

• Accession: MIMAT0017064
• Previous IDs: mmu-miR-135a-2*
• Sequence: 62 - uguagggauggaagccaugaa - 82
• Deep sequencing: 5487 reads, 53 experiments
• Evidence: experimental; Illumina [5]
• Database links:
  • RNAcentral:URS000006F100_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-135a-2-3p
  • miRDB:mmu-miR-135a-2-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).