Stem-loop sequence mmu-mir-224

AccessionMI0000711 (change log)
Symbol MGI:Mir224
DescriptionMus musculus miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

44 open access papers mention mmu-mir-224
(146 sentences)

Stem-loop
          ua         u   u      a u   ug  uu 
5' gggcuuu  agucacuag ggu ccguuu g aga  gu  g
   |||||||  ||||||||| ||| |||||| | |||  ||   
3' cccgaaa  ucagugauc ccg gguaaa c uuu  ua  u
          ca         -   u      a -   gu  cg 
Get sequence
Deep sequencing
15873 reads, 11.6 reads per million, 86 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-224 is predicted [2] based on homology to a cloned miR from human (MI0000301) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 72261031-72261112 [-]
sense
OTTMUST00000043189 ; Gabre-001; intron 6
ENSMUST00000064780 ; Gabre-001; intron 6
Clustered miRNAs
< 10kb from mmu-mir-224
mmu-mir-452chrX: 72262224-72262308 [-]
mmu-mir-224chrX: 72261031-72261112 [-]
Database links

Mature sequence mmu-miR-224-5p

Accession MIMAT0000671
Previous IDsmmu-miR-224
Sequence

8 - 

uaagucacuagugguuccguu

 - 28

Get sequence
Deep sequencing15692 reads, 86 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-224-3p

Accession MIMAT0017062
Previous IDsmmu-miR-224*
Sequence

55 - 

aaauggugcccuagugacuaca

 - 76

Get sequence
Deep sequencing177 reads, 19 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).