![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-218-2 |
|||||
Accession | MI0000701 (change log) | ||||
Symbol | MGI:Mir218-2 | ||||
Description | Mus musculus miR-218-2 stem-loop | ||||
Gene family | MIPF0000026; mir-218 | ||||
Literature search |
![]()
71 open access papers mention mmu-mir-218-2 | ||||
Stem-loop |
gac uu -cc gg uuu cu gguggaacga g 5' cag g gcg gcuuucc gugcuugau aaccaugu ug a ||| | ||| ||||||| ||||||||| |||||||| || 3' guc c cgc cgaaagg cacgaacug uugguaca gc a -ac cu ucu ua cgc uc --------ag a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MI0000295) [1]. Its expression was later verified by cloning [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-218-5p |
|
Accession | MIMAT0000663 |
Previous IDs | mmu-miR-218 |
Sequence |
25 - uugugcuugaucuaaccaugu - 45 |
Deep sequencing | 316666 reads, 79 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-218-2-3p |
|
Accession | MIMAT0005444 |
Previous IDs | mmu-miR-218-2* |
Sequence |
67 - caugguucugucaagcaccgcg - 88 |
Deep sequencing | 1467 reads, 53 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|