Stem-loop sequence mmu-mir-218-2

AccessionMI0000701 (change log)
Symbol MGI:Mir218-2
DescriptionMus musculus miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Literature search

71 open access papers mention mmu-mir-218-2
(539 sentences)

Stem-loop
   gac   uu -cc   gg       uuu         cu        gguggaacga  g 
5'    cag  g   gcg  gcuuucc   gugcuugau  aaccaugu          ug a
      |||  |   |||  |||||||   |||||||||  ||||||||          ||  
3'    guc  c   cgc  cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cu ucu   ua       cgc         uc        --------ag  a 
Get sequence
Deep sequencing
160101 reads, 991 reads per million, 82 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MI0000295) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 35616816-35616925 [+]
sense
OTTMUST00000012061 ; Slit3-001; intron 14
ENSMUST00000069837 ; Slit3-001; intron 14
Database links

Mature sequence mmu-miR-218-5p

Accession MIMAT0000663
Previous IDsmmu-miR-218
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing316666 reads, 79 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-218-2-3p

Accession MIMAT0005444
Previous IDsmmu-miR-218-2*
Sequence

67 - 

caugguucugucaagcaccgcg

 - 88

Get sequence
Deep sequencing1467 reads, 53 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).