Stem-loop sequence mmu-mir-218-1

AccessionMI0000700 (change log)
Symbol MGI:Mir218-1
DescriptionMus musculus miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Literature search

72 open access papers mention mmu-mir-218-1
(598 sentences)

Stem-loop
   gugauaaugga   a   u      u         cu        ---g   gcg 
5'            gcg gau uucugu gugcuugau  aaccaugu    cuu   a
              ||| ||| |||||| |||||||||  ||||||||    |||   g
3'            cgc cug aaggua cacgaacug  uugguaca    gag   g
   acaucuuucga   a   c      c         cc        aaaa   uau 
Get sequence
Deep sequencing
159947 reads, 1.05e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MI0000294) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 48223942-48224051 [+]
sense
OTTMUST00000096636 ; Slit2-013; intron 1
OTTMUST00000096653 ; Slit2-016; intron 8
OTTMUST00000096559 ; Slit2-003; intron 14
OTTMUST00000096561 ; Slit2-001; intron 14
OTTMUST00000096560 ; Slit2-002; intron 15
OTTMUST00000096578 ; Slit2-008; intron 15
OTTMUST00000096562 ; Slit2-006; intron 16
OTTMUST00000096577 ; Slit2-007; intron 16
ENSMUST00000172824 ; Slit2-013; intron 1
ENSMUST00000174487 ; Slit2-016; intron 8
ENSMUST00000033967 ; Slit2-003; intron 14
ENSMUST00000170109 ; Slit2-001; intron 14
ENSMUST00000174313 ; Slit2-002; intron 15
ENSMUST00000173107 ; Slit2-008; intron 15
ENSMUST00000174421 ; Slit2-006; intron 16
ENSMUST00000173702 ; Slit2-007; intron 16
Database links

Mature sequence mmu-miR-218-5p

Accession MIMAT0000663
Previous IDsmmu-miR-218
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing316666 reads, 79 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-218-1-3p

Accession MIMAT0004665
Previous IDsmmu-miR-218-1*
Sequence

64 - 

aaacaugguuccgucaagcacc

 - 85

Get sequence
Deep sequencing1381 reads, 57 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).