![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-216a |
||||||
Accession | MI0000699 (change log) | |||||
Previous IDs | mmu-mir-216 | |||||
Symbol | MGI:Mir216a | |||||
Description | Mus musculus miR-216a stem-loop | |||||
Gene family | MIPF0000054; mir-216 | |||||
Literature search |
![]()
24 open access papers mention mmu-mir-216a | |||||
Stem-loop |
u u cu a -- uc 5' uggu uaaucucag ggc acugugag aug c |||| ||||||||| ||| |||||||| ||| c 3' aucg auuaggguc cug ugacacuc uac u a u -u g cu ua |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Mouse mir-216 is predicted [2] based on homology to a reported miR from human (MI0000292) [1]. Its expression was later verified by cloning [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-216a-5p |
|
Accession | MIMAT0000662 |
Previous IDs | mmu-miR-216;mmu-miR-216a |
Sequence |
7 - uaaucucagcuggcaacuguga - 28 |
Deep sequencing | 1786 reads, 32 experiments |
Evidence | experimental; cloned [3], Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-216a-3p |
|
Accession | MIMAT0017054 |
Previous IDs | mmu-miR-216a* |
Sequence |
47 - cacaguggucucugggauuaug - 68 |
Deep sequencing | 442 reads, 16 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|