miRBase entry: mmu-mir-181a-1

Stem-loop mmu-mir-181a-1


Accession
MI0000697
Symbol
MGI: Mir181a-1
Description
Mus musculus mmu-mir-181a-1 precursor miRNA
Gene family
MIPF0000007; mir-181

Literature search
213 open access papers mention mmu-mir-181a-1
(1807 sentences)

Sequence

4244711 reads, 6982 reads per million, 107 experiments
gguugcuucagugAACAUUCAACGCUGUCGGUGAGUuuggaauucaaauaaaaACCAUCGACCGUUGAUUGUACCcuauagcuaacc
(((((((..((.(.(((.((((((..(((((((.((((.............))))))))))))))))).))).).))..))).))))

Structure
    -   uc  u A   U      CU       A    ggaau 
gguu gcu  ag g ACA UCAACG  GUCGGUG GUuu     u
|||| |||  || | ||| ||||||  ||||||| ||||     c
ccaa cga  uc C UGU AGUUGC  CAGCUAC CAaa     a
    u   ua  C A   U      --       -    aauaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 137966455-137966541 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-181a-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-181a-5p

Accession MIMAT0000210
Description Mus musculus mmu-miR-181a-5p mature miRNA
Sequence 14 - AACAUUCAACGCUGUCGGUGAGU - 36
Evidence experimental
cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-181a-1-3p

Accession MIMAT0000660
Description Mus musculus mmu-miR-181a-1-3p mature miRNA
Sequence 54 - ACCAUCGACCGUUGAUUGUACC - 75
Evidence experimental
cloned [2], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73