Stem-loop sequence mmu-mir-28a

Accession

MI0000690 (change log)

Previous IDs

mmu-mir-28

Symbol

MGI:Mir28a

Description

Mus musculus miR-28 stem-loop

Gene family

MIPF0000057; mir-28

Literature search

22 open access papers mention mmu-mir-28a
(158 sentences)

Stem-loop

      c   a     a  g             ----uu     gcc 
5' ggu ccu ccuuc ag agcucacagucua      gaguu   u
   ||| ||| ||||| || |||||||||||||      |||||    
3' uca gga gggag uc ucgaguguuagau      cuuag   u
      c   c     g  g             cacccu     ucu 

Deep sequencing

305696 reads, 770 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse mir-28 is predicted [2] based on homology to a cloned miR from human (MI0000086) [1]. Its expression was later verified by cloning [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr16: 24827855-24827940 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000115314 ; Lpp-203; intron 3

  ENSMUST00000078988 ; Lpp-202; intron 7

  ENSMUST00000038053 ; Lpp-201; intron 8

Database links

• EntrezGene:Mirn28
• MGI:Mir28a
• RNAcentral:URS000066FA7E_10090
• miRBase Tracker:MI0000690

Mature sequence mmu-miR-28a-5p

• Accession: MIMAT0000653
• Previous IDs: mmu-miR-28;mmu-miR-28-5p
• Sequence: 14 - aaggagcucacagucuauugag - 35
• Deep sequencing: 197001 reads, 107 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00003E47B1_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-28a-5p
  • miRDB:mmu-miR-28a-5p
  • microrna.org:mmu-miR-28a-5p

Mature sequence mmu-miR-28a-3p

• Accession: MIMAT0004661
• Previous IDs: mmu-miR-28*;mmu-miR-28-3p
• Sequence: 54 - cacuagauugugagcugcugga - 75
• Deep sequencing: 108687 reads, 106 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS0000227253_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-28a-3p
  • miRDB:mmu-miR-28a-3p
  • microrna.org:mmu-miR-28a-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).