![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR169a |
|||||
Accession | MI0000679 (change log) | ||||
Previous IDs | osa-MIR169 | ||||
Description | Oryza sativa miR169a stem-loop | ||||
Gene family | MIPF0000037; MIR169_2 | ||||
Literature search |
![]()
65 open access papers mention osa-MIR169a | ||||
Stem-loop |
--- - g u u a u c ug c c cu --a 5' cgcc ggc ggccu acau ggga cgg ggcca ggug agccaagga acuugccgau gau gau aucuaug agcuaa |||| ||| ||||| |||| |||| ||| ||||| |||| ||||||||| |||||||||| ||| ||| ||||||| ||||| g 3' gcgg ccg ccgga ugua uccu guc ccggu cuac ucgguucuu ugaacgguua cua cua uagguac ucgauc ugu g a c c c u a gu a c cc cgg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR169a |
|
Accession | MIMAT0000644 |
Sequence |
38 - cagccaaggaugacuugccga - 58 |
Deep sequencing | 6152 reads, 2 experiments |
Evidence | by similarity; MI0000212 |
Database links |
|
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|