![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR156i |
|||||
Accession | MI0000661 (change log) | ||||
Description | Oryza sativa miR156i stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
119 open access papers mention osa-MIR156i | ||||
Stem-loop |
- - a g cgga cgg 5' ggugacaga agag agugagcac cggccg g acggcac c ||||||||| |||| ||||||||| |||||| | ||||||| 3' cuacugucu ucuc ucacucgug gccggc c ugccgug g g g c g ---- uag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR156i |
|
Accession | MIMAT0000626 |
Sequence |
3 - ugacagaagagagugagcac - 22 |
Deep sequencing | 560064 reads, 2 experiments |
Evidence | by similarity; MI0000178 |
Database links |
|
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|