Stem-loop sequence hsa-mir-1-1

Accession

MI0000651 (change log)

Previous IDs

hsa-mir-1b

Symbol

HGNC:MIR1-1

Description

Homo sapiens miR-1-1 stem-loop

Gene family

MIPF0000038; mir-1

Literature search

517 open access papers mention hsa-mir-1-1
(2629 sentences)

Stem-loop

   u    a                gc     ---   a 
5'  ggga acauacuucuuuauau  ccaua   ugg c
    |||| ||||||||||||||||  |||||   ||| c
3'  cucu uguaugaagaaaugua  gguau   auc u
   a    a                -a     cga   g 

Deep sequencing

9922471 reads, 6.51e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MI0000651, mouse MI0000139), and mir-1-2 (human MI0000437, mouse MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr20: 62554306-62554376 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000080244 ; DNAJC5-001; intron 1

  OTTHUMT00000080245 ; DNAJC5-002; intron 1

  ENST00000360864 ; DNAJC5-001; intron 1

  ENST00000470551 ; DNAJC5-002; intron 1

  ENST00000369911 ; DNAJC5-201; intron 1

Database links

• EntrezGene:MIR1-1
• HGNC:MIR1-1
• RNAcentral:URS000075CF56_9606
• Rfam:mir-1
• miRBase Tracker:MI0000651

Mature sequence hsa-miR-1-5p

• Accession: MIMAT0031892
• Sequence: 7 - acauacuucuuuauaugcccau - 28
• Deep sequencing: 864 reads, 89 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000075C105_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-1-5p
  • miRDB:hsa-miR-1-5p

Mature sequence hsa-miR-1-3p

• Accession: MIMAT0000416
• Previous IDs: hsa-miR-1
• Sequence: 46 - uggaauguaaagaaguauguau - 67
• Deep sequencing: 21440115 reads, 159 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS00001DC04F_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-1-3p
  • miRDB:hsa-miR-1-3p
  • microrna.org:hsa-miR-1-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).