![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-350-1 |
|||||
Accession | MI0000639 (change log) | ||||
Previous IDs | rno-mir-350 | ||||
Description | Rattus norvegicus miR-350-1 stem-loop | ||||
Gene family | MIPF0000245; mir-350 | ||||
Literature search |
3 open access papers mention rno-mir-350-1 | ||||
Stem-loop |
agaugccuug c a - cac u - gugag 5' cuccua aag gu aaagug g gcuuug ggaca g |||||| ||| || |||||| | |||||| ||||| a 3' gaggau uuc ca uuucac c cgaaac cuugu a -----guuga - c c aua c a aauaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has a predicted homologue in mouse (MI0000640). The sequence reported in [1] contains a 5' terminal A residue, which conflicts with the precursor sequence shown here. |
||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-350 |
|
Accession | MIMAT0000604 |
Sequence |
61 - uucacaaagcccauacacuuucac - 84 |
Deep sequencing | 10102 reads, 435 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|