Stem-loop sequence rno-mir-344a-1

AccessionMI0000629 (change log)
Previous IDsrno-mir-344;rno-mir-344-1
DescriptionRattus norvegicus miR-344a-1 stem-loop
Gene family MIPF0000267; mir-344
Literature search

8 open access papers mention rno-mir-344a-1
(73 sentences)

Stem-loop 
       ----  agg        ------          cc         uc        a 
5' gcag    cc   guuuuuac      cagucaggcu  uggcuagau  cagguacc a
   ||||    ||   ||||||||      ||||||||||  |||||||||  ||||||||  
3' cguc    gg   caaaaaug      gucaguccga  accgaucua  guccaugg c
       agaa  aaa        ucgaau          -a         --        u
Get sequence
Deep sequencing
17479 reads, 9.26 reads per million, 216 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 122309549-122309655 [-]
intergenic
Database links

Mature sequence rno-miR-344a-5p

Accession MIMAT0004654
Previous IDsrno-miR-344-5p
Sequence

21 -  

ucaggcuccuggcuagauu

 - 39

Get sequence
Deep sequencing66 reads, 24 experiments
Evidence experimental; SOLiD [1]

Mature sequence rno-miR-344a-3p

Accession MIMAT0000592
Previous IDsrno-miR-344;rno-miR-344-3p
Sequence

59 -  

ugaucuagccaaagccugacugu

 - 81

Get sequence
Deep sequencing17440 reads, 215 experiments
Evidence experimental; cloned [1], Northern [1], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).