Stem-loop sequence mmu-mir-342

Accession

MI0000627 (change log)

Symbol

MGI:Mir342

Description

Mus musculus miR-342 stem-loop

Gene family

MIPF0000190; mir-342

Literature search

50 open access papers mention mmu-mir-342
(378 sentences)

Stem-loop

   gaaaau    u        g      --ua      auuga      ugg  a 
5'       gggc caagguga gggugc    ucugug     gggaca   uc a
         |||| |||||||| ||||||    ||||||     ||||||   ||  
3'       uccg guuccacu cccacg    agacac     cucugu   ag u
   -agucg    -        g      cuaa      ----a      -ua  g 

Deep sequencing

228828 reads, 634 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000626). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr12: 108658620-108658718 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000021689 ; Evl-201; intron 3

  ENSMUST00000077735 ; Evl-202; intron 3

  ENSMUST00000109854 ; Evl-203; intron 3

  ENSMUST00000172409 ; Evl-204; intron 4

Database links

• EntrezGene:Mirn342
• MGI:Mir342
• RNAcentral:URS00006D63BB_10090
• miRBase Tracker:MI0000627

Mature sequence mmu-miR-342-5p

• Accession: MIMAT0004653
• Sequence: 19 - aggggugcuaucugugauugag - 40
• Deep sequencing: 31759 reads, 103 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00003345F0_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-342-5p
  • miRDB:mmu-miR-342-5p
  • microrna.org:mmu-miR-342-5p

Mature sequence mmu-miR-342-3p

• Accession: MIMAT0000590
• Previous IDs: mmu-miR-342
• Sequence: 61 - ucucacacagaaaucgcacccgu - 83
• Deep sequencing: 195997 reads, 107 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS0000148B91_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-342-3p
  • miRDB:mmu-miR-342-3p
  • microrna.org:mmu-miR-342-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).