Stem-loop rno-mir-342

Accession

MI0000626

Description

Rattus norvegicus rno-mir-342 precursor miRNA

Gene family

MIPF0000190; mir-342

Literature search

15 open access papers mention rno-mir-342
(33 sentences)

Sequence

75343 reads, 114 reads per million, 491 experiments

gaaaaugggcucaaggugAGGGGUGCUAUCUGUGAUUGAGggacauggucaauggaauugUCUCACACAGAAAUCGCACCCGUcaccuuggccugcuga
......((((.((((((((.((((((..((((((..(((((.((((.....)))....).)))))))))))....)))))).)))))))))))).....

Structure

gaaaau    u        G      --UA      AU     g ----   g 
      gggc caaggugA GGGUGC    UCUGUG  UGAGg a    cau g
      |||| |||||||| ||||||    ||||||  ||||| |    ||| u
      uccg guuccacU CCCACG    AGACAC  ACUCU u    gua c
-agucg    -        G      CUAA      --     g uaag   a 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr6: 132561169-132561267 [+]

Mature rno-miR-342-5p

• Accession: MIMAT0004652
• Description: Rattus norvegicus rno-miR-342-5p mature miRNA
• Sequence: 19 - AGGGGUGCUAUCUGUGAUUGAG - 40
• Evidence: experimental ; cloned [4], SOLiD [5]

Mature rno-miR-342-3p

• Accession: MIMAT0000589
• Description: Rattus norvegicus rno-miR-342-3p mature miRNA
• Sequence: 61 - UCUCACACAGAAAUCGCACCCGU - 83
• Evidence: experimental ; cloned [1-4], Northern [1], SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68