Stem-loop sequence rno-mir-342

Accession

MI0000626 (change log)

Description

Rattus norvegicus miR-342 stem-loop

Gene family

MIPF0000190; mir-342

Literature search

15 open access papers mention rno-mir-342
(33 sentences)

Stem-loop

   gaaaau    u        g      --ua      auuga      ugg  a 
5'       gggc caagguga gggugc    ucugug     gggaca   uc a
         |||| |||||||| ||||||    ||||||     ||||||   ||  
3'       uccg guuccacu cccacg    agacac     cucugu   ag u
   -agucg    -        g      cuaa      ----a      -ua  g 

Deep sequencing

88232 reads, 29.3 reads per million, 492 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr6: 132561169-132561267 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000019583 ; Evl-201; intron 2

Database links

• EntrezGene:Mir342
• miRBase Tracker:MI0000626

Mature sequence rno-miR-342-5p

• Accession: MIMAT0004652
• Sequence: 19 - aggggugcuaucugugauugag - 40
• Deep sequencing: 4495 reads, 403 experiments
• Evidence: experimental; cloned [4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-342-5p
  • miRDB:rno-miR-342-5p
  • microrna.org:rno-miR-342-5p

Mature sequence rno-miR-342-3p

• Accession: MIMAT0000589
• Previous IDs: rno-miR-342
• Sequence: 61 - ucucacacagaaaucgcacccgu - 83
• Deep sequencing: 83558 reads, 492 experiments
• Evidence: experimental; cloned [1-4], Northern [1], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-342-3p
  • miRDB:rno-miR-342-3p
  • microrna.org:rno-miR-342-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).