Stem-loop sequence mmu-mir-341

Accession

MI0000625 (change log)

Symbol

MGI:Mir341

Description

Mus musculus miR-341 stem-loop

Gene family

MIPF0000269; mir-341

Literature search

8 open access papers mention mmu-mir-341
(30 sentences)

Stem-loop

   aaaau   --  u   ag       gu          cu   u   u a 
5'      gau  ga guc  uuggccg  cggccgaucg  cgg cug c g
        |||  || |||  |||||||  ||||||||||  ||| ||| | u
3'      cug  cu cgg  gacuggc  gcuggcuagc  gcu ggc g c
   --cuu   uc  u   cu       ug          ug   -   u a 

Deep sequencing

58114 reads, 115 reads per million, 92 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000624) - its expression was later verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr12: 109611500-109611595 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000113328 ; Rian-010; intron 2

  OTTMUST00000113329 ; Rian-012; intron 2

  ENSMUST00000183215 ; Rian-010; intron 2

  ENSMUST00000182689 ; Rian-012; intron 2

Clustered miRNAs

< 10kb from mmu-mir-341

• mmu-mir-341: chr12: 109611500-109611595 [+]
• mmu-mir-1188: chr12: 109611822-109611941 [+]
• mmu-mir-370: chr12: 109618258-109618336 [+]

Database links

• EntrezGene:Mirn341
• MGI:Mir341
• RNAcentral:URS000075DD8F_10090
• miRBase Tracker:MI0000625

Mature sequence mmu-miR-341-5p

• Accession: MIMAT0017037
• Previous IDs: mmu-miR-341*
• Sequence: 22 - cggucggccgaucgcucgguc - 42
• Deep sequencing: 360 reads, 24 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS00004C779A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-341-5p
  • miRDB:mmu-miR-341-5p

Mature sequence mmu-miR-341-3p

• Accession: MIMAT0000588
• Previous IDs: mmu-miR-341
• Sequence: 57 - ucggucgaucggucggucggu - 77
• Deep sequencing: 57639 reads, 89 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00001390DD_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-341-3p
  • miRDB:mmu-miR-341-3p
  • microrna.org:mmu-miR-341-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).