Stem-loop sequence rno-mir-341

AccessionMI0000624 (change log)
DescriptionRattus norvegicus miR-341 stem-loop
Gene family MIPF0000269; mir-341
Literature search

4 open access papers mention rno-mir-341
(7 sentences)

Stem-loop 
   aaaau   --  u   ag       gu          cu   u   u a 
5'      gau  ga guc  uuggccg  cggccgaucg  cgg cug c g
        |||  || |||  |||||||  ||||||||||  ||| ||| | u
3'      cug  cu cgg  gacuggc  gcuggcuagc  gcu ggc g c
   --cuu   uc  u   cu       ug          ug   -   u a
Get sequence
Deep sequencing
589615 reads, 380 reads per million, 461 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133733240-133733335 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-341
rno-mir-341chr6: 133733240-133733335 [+]
rno-mir-1188chr6: 133733578-133733659 [+]
rno-mir-370chr6: 133739916-133739994 [+]
Database links

Mature sequence rno-miR-341

Accession MIMAT0000587
Sequence

57 -  

ucggucgaucggucggucggu

 - 77

Get sequence
Deep sequencing588292 reads, 459 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).