Stem-loop sequence rno-mir-339

AccessionMI0000620 (change log)
DescriptionRattus norvegicus miR-339 stem-loop
Gene family MIPF0000193; mir-339
Literature search

5 open access papers mention rno-mir-339
(48 sentences)

Stem-loop 
   ----------ac         a c u c     c  c   a      --   u 
5'             gggguggac c g c cuguc uc agg gcucac  gua g
               ||||||||| | | | ||||| || ||| ||||||  |||  
3'             ccccaccug g c g gacag ag ucc cgagug  cgu c
   aacccgucacgu         a a c a     c  c   g      uc   c
Get sequence
Deep sequencing
99490 reads, 39.8 reads per million, 493 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-339-5p sequence reported in [1] contains two 3' terminal U residues, which conflict with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr12: 17369002-17369097 [+]
sense
ENSRNOT00000001734 ; 3110082I17Rik-201; intron 2
Database links

Mature sequence rno-miR-339-5p

Accession MIMAT0000583
Previous IDsrno-miR-339
Sequence

16 -  

ucccuguccuccaggagcucacg

 - 38

Get sequence
Deep sequencing52670 reads, 491 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-339-3p

Accession MIMAT0004648
Sequence

51 -  

ugagcgccucgacgacagagcca

 - 73

Get sequence
Deep sequencing46603 reads, 489 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).