Stem-loop sequence mmu-mir-337

AccessionMI0000615 (change log)
Symbol MGI:Mir337
DescriptionMus musculus miR-337 stem-loop
Gene family MIPF0000195; mir-337
Literature search

16 open access papers mention mmu-mir-337
(54 sentences)

Stem-loop 
   caguguagugagaa uu         -   c         c         u  ca 
5'               g  ggggggugg gaa ggcgucaug aggaguuga ug  c
                 |  ||||||||| ||| ||||||||| ||||||||| ||   
3'               c  ucccccacu cuu ccguaguau uccucgacu ac  a
   -------------a -u         u   u         a         u  cg
Get sequence
Deep sequencing
31146 reads, 114 reads per million, 91 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000614). Seitz et al. later predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the hairpin, named here miR-337-5p and miR-337-3p [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109585789-109585885 [+]
sense
ENSMUST00000083592 ; Mir337-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-337
mmu-mir-493chr12: 109580233-109580315 [+]
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-337-5p

Accession MIMAT0004644
Sequence

30 -  

cggcgucaugcaggaguugauu

 - 51

Get sequence
Deep sequencing24317 reads, 87 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-337-3p

Accession MIMAT0000578
Previous IDsmmu-miR-337
Sequence

62 -  

ucagcuccuauaugaugccuuu

 - 83

Get sequence
Deep sequencing6821 reads, 65 experiments
Evidence experimental; PCR [2], cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).