![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-337 |
||||||||||||||||||||||
Accession | MI0000614 (change log) | |||||||||||||||||||||
Description | Rattus norvegicus miR-337 stem-loop | |||||||||||||||||||||
Gene family | MIPF0000195; mir-337 | |||||||||||||||||||||
Literature search |
5 open access papers mention rno-mir-337 | |||||||||||||||||||||
Stem-loop |
aguguagugagaa uu - c c u ca 5' g ggggggugg gaa ggcgucaug aggaguuga ug c | ||||||||| ||| ||||||||| ||||||||| || 3' c ucccccacu cuu ccguaguau uccucgacu ac a -----------aa -u u u a u cg |
|||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||
Database links |
Mature sequence rno-miR-337-5p |
|
Accession | MIMAT0017035 |
Previous IDs | rno-miR-337* |
Sequence |
29 - cggcgucaugcaggaguugau - 49 |
Deep sequencing | 39331 reads, 351 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-337-3p |
|
Accession | MIMAT0000577 |
Previous IDs | rno-miR-337 |
Sequence |
60 - uucagcuccuauaugaugccuuu - 82 |
Deep sequencing | 6254 reads, 238 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|