Stem-loop sequence rno-mir-335

AccessionMI0000612 (change log)
DescriptionRattus norvegicus miR-335 stem-loop
Gene family MIPF0000196; mir-335
Literature search

15 open access papers mention rno-mir-335
(139 sentences)

Stem-loop 
   --------ucuuu    c        a         c        uuu    u 
5'              uggg ggggguca gagcaauaa gaaaaaug   guuu u
                |||| |||||||| ||||||||| ||||||||   |||| c
3'              acuc ccuccagu cucguuauu cuuuuugc   caaa g
   accgauauuguuu    u        c         a        ---    u
Get sequence
Deep sequencing
142449 reads, 68.9 reads per million, 476 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rno-miR-335

Accession MIMAT0000575
Sequence

16 -  

ucaagagcaauaacgaaaaaugu

 - 38

Get sequence
Deep sequencing93940 reads, 472 experiments
Evidence experimental; cloned [1-2], Northern [1]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).