miRBase entry: mmu-mir-328

Stem-loop mmu-mir-328


Accession
MI0000603
Symbol
MGI: Mir328
Description
Mus musculus mmu-mir-328 precursor miRNA
Gene family
MIPF0000203; mir-328

Literature search
34 open access papers mention mmu-mir-328
(179 sentences)

Sequence

31967 reads, 218 reads per million, 106 experiments
cugucucggagccuggggcaGGGGGGCAGGAGGGGCUCAGGGagaaaguaucuacagcccCUGGCCCUCUCUGCCCUUCCGUccccuguccccaagu
..........((.(((((((((((((((((.(((((.((((((((.....))).....)))))))))).)))))).......)))))).))))).))

Structure
cugucucgga  c     -      -------      A     U     -----   a 
          gc ugggg caGGGG       GGCAGG GGGGC CAGGG     aga a
          || ||||| ||||||       |||||| ||||| |||||     ||| g
          ug acccc gucccc       CCGUCU UCCCG GUCcc     ucu u
----------  a     u      UGCCUUC      C     -     cgaca   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000602) - its expression was later independently verified in mouse [2].

Genome context
chr8: 105308364-105308460 [-]

Database links

Mature mmu-miR-328-5p

Accession MIMAT0017030
Description Mus musculus mmu-miR-328-5p mature miRNA
Sequence 21 - GGGGGGCAGGAGGGGCUCAGGG - 42
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-328-3p

Accession MIMAT0000565
Description Mus musculus mmu-miR-328-3p mature miRNA
Sequence 61 - CUGGCCCUCUCUGCCCUUCCGU - 82
Evidence experimental
cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365