Stem-loop sequence rno-let-7d

AccessionMI0000601 (change log)
DescriptionRattus norvegicus let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

105 open access papers mention rno-let-7d
(541 sentences)

Stem-loop 
   u    u       a              c      -------uua         
5'  gggc ccuagga gagguaguagguug auaguu          gggcagag 
    |||| ||||||| |||||||||||||| ||||||          ||||||| a
3'  uccg ggauucu uuccgucguccagc uaucaa          cccguuuu 
   u    -       -              a      uugaggaaca
Get sequence
Deep sequencing
1299109 reads, 985 reads per million, 508 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons, including the sequence identical to the miRNA cloned from the reverse strand of mouse let-7d (MI0000405), named let-7* [1]. The predicted precursor sequence from a newer assembly of the rat genome also contains the let-7d sequence in the 5' arm. The let-7d* sequence published in [1] had an extra 3' A residue, which conflicts with the sequence of the precursor shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 16419980-16420077 [+]
intergenic
Clustered miRNAs
< 10kb from rno-let-7d
rno-let-7a-1chr17: 16417853-16417946 [+]
rno-mir-3596dchr17: 16418217-16418313 [-]
rno-let-7f-1chr17: 16418221-16418309 [+]
rno-let-7dchr17: 16419980-16420077 [+]
rno-mir-3596bchr17: 16419981-16420075 [-]
Database links

Mature sequence rno-let-7d-5p

Accession MIMAT0000562
Previous IDsrno-let-7d
Sequence

14 -  

agagguaguagguugcauaguu

 - 35

Get sequence
Deep sequencing1002882 reads, 506 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

Mature sequence rno-let-7d-3p

Accession MIMAT0000563
Previous IDsrno-let-7d*
Sequence

68 -  

cuauacgaccugcugccuuucu

 - 89

Get sequence
Deep sequencing296214 reads, 496 experiments
Evidence experimental; cloned [1,4], Northern [1], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).