![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-327 |
|||||
Accession | MI0000600 (change log) | ||||
Description | Rattus norvegicus miR-327 stem-loop | ||||
Gene family | MIPF0000438; mir-327 | ||||
Literature search |
4 open access papers mention rno-mir-327 | ||||
Stem-loop |
--------------------- -- c uccuu g g g 5' gucuga ugcc uca gaggggcau agg ua u |||||| |||| ||| ||||||||| ||| || c 3' caggcu acgg agu cucccugua ucc au a ggaguguucgguaagguugua uc u ----u g g g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. |
||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-327 |
|
Accession | MIMAT0000561 |
Sequence |
16 - ccuugaggggcaugagggu - 34 |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|