![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-323 |
||||||||||||||||||||||||||||||||||
Accession | MI0000592 (change log) | |||||||||||||||||||||||||||||||||
Symbol | MGI:Mir323 | |||||||||||||||||||||||||||||||||
Description | Mus musculus miR-323 stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||
Literature search |
![]()
13 open access papers mention mmu-mir-323 | |||||||||||||||||||||||||||||||||
Stem-loop |
---uu u g g u gcgc u uca 5' gguacu g agagaggu g ccgug gu cgcu u |||||| | |||||||| | ||||| || |||| 3' cuaugg c uuucucca c ggcac ca gcgg u cuaau - g g u auua c uau |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000591). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-323-5p |
|
Accession | MIMAT0004638 |
Sequence |
16 - aggugguccguggcgcguucgc - 37 |
Deep sequencing | 4108 reads, 39 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-323-3p |
|
Accession | MIMAT0000551 |
Previous IDs | mmu-miR-323 |
Sequence |
51 - cacauuacacggucgaccucu - 71 |
Deep sequencing | 20331 reads, 84 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|