Stem-loop sequence mmu-mir-322

Accession

MI0000590 (change log)

Symbol

MGI:Mir322

Description

Mus musculus miR-322 stem-loop

Gene family

MIPF0000164; mir-322

Literature search

43 open access papers mention mmu-mir-322
(376 sentences)

Stem-loop

   ccucguuga   -       c  ca     aa             g auu 
5'          cuc cgaaggg ug  gcagc  uucauguuuugga u   g
            ||| ||||||| ||  |||||  ||||||||||||| |    
3'          ggg gcuuccc ac  cgucg  aaguacaaaacuu g   c
   ------aag   u       c  aa     cg             g aac 

Deep sequencing

720570 reads, 3.79e+03 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mir-322 locus appears able to express two mature miRNA sequences. Poy et al. cloned a sequence originating from the 5' arm from mouse pancreatic beta cells [2]. This sequence is orthologous to the experimentally validated miR-424 sequence from human (MI0001446), but was named miR-322-5p in [2]. The mature product from the 3' arm of this precursor sequence is the predicted mouse homologue of miR-322, experimentally verified in rat (MI0000589) [1], and later in mouse [3]. The orthologous human locus does not appear to contain the miR-322 sequence. Landgraf et al. confirm that the 5' product is the predominant one [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 53054255-53054349 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-322

• mmu-mir-322: chrX: 53054255-53054349 [-]
• mmu-mir-503: chrX: 53053984-53054054 [-]
• mmu-mir-351: chrX: 53053255-53053353 [-]
• mmu-mir-542: chrX: 53049403-53049487 [-]
• mmu-mir-450a-2: chrX: 53048299-53048367 [-]
• mmu-mir-450a-1: chrX: 53048154-53048244 [-]
• mmu-mir-450b: chrX: 53047997-53048078 [-]

Database links

• EntrezGene:Mirn322
• MGI:Mir322
• RNAcentral:URS000075CE99_10090
• miRBase Tracker:MI0000590

Mature sequence mmu-miR-322-5p

• Accession: MIMAT0000548
• Previous IDs: mmu-miR-322-5p;mmu-miR-424;mmu-miR-322
• Sequence: 23 - cagcagcaauucauguuuugga - 44
• Deep sequencing: 524283 reads, 106 experiments
• Evidence: experimental; cloned [2,4], Illumina [5-6]
• Database links:
  • RNAcentral:URS000040C1ED_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-322-5p
  • miRDB:mmu-miR-322-5p
  • microrna.org:mmu-miR-322-5p

Mature sequence mmu-miR-322-3p

• Accession: MIMAT0000549
• Previous IDs: mmu-miR-322-3p;mmu-miR-322;mmu-miR-322*
• Sequence: 61 - aaacaugaagcgcugcaacac - 81
• Deep sequencing: 196152 reads, 104 experiments
• Evidence: experimental; cloned [3-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS00000565C2_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-322-3p
  • miRDB:mmu-miR-322-3p
  • microrna.org:mmu-miR-322-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).