![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-96 |
||||||||
Accession | MI0000583 (change log) | |||||||
Symbol | MGI:Mir96 | |||||||
Description | Mus musculus miR-96 stem-loop | |||||||
Gene family | MIPF0000072; mir-96 | |||||||
Literature search |
![]()
104 open access papers mention mmu-mir-96 | |||||||
Stem-loop |
c cca gg g u g uu ug - cu 5' cagua ucugcuu cc au uuggcacua cacau uugcu u gu c ||||| ||||||| || || ||||||||| ||||| ||||| | || 3' gucgu gggcgaa gg ua aaccgugau gugua aacga g cg u c --c aa g u - cu gu u cc |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-96-5p |
|
Accession | MIMAT0000541 |
Previous IDs | mmu-miR-96 |
Sequence |
24 - uuuggcacuagcacauuuuugcu - 46 |
Deep sequencing | 55278 reads, 95 experiments |
Evidence | experimental; cloned [1-3], Northern [1], Illumina [4,6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-96-3p |
|
Accession | MIMAT0017021 |
Previous IDs | mmu-miR-96* |
Sequence |
66 - caaucauguguagugccaauau - 87 |
Deep sequencing | 122 reads, 32 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|