Mmu-mir-31 is a microRNA that is expressed in mice and is upregulated in response to M. bovis BCG infection [PMC4097432]. It has been found to have different isoforms, such as hsa-miR-31, ptr-miR-31, and mmu-mir-31, which have slight variations in their sequences [PMC3759948]. Mmu-mir-31 is one of the top miRNAs enriched in the mammary glands of pubertal mice and is expressed in all stages of development [PMC8944794]. It has been studied using microRNA real-time PCR amplification with TaqMan assays [PMC3510057]. Mmu-mir-31 has been used to generate transgenic mice for research purposes [PMC5648844]. The transcription start site for mmu-mir-31 has been determined using RNA sequencing data [PMC6291424]. The expression of mmu-mir-31 has been found to be upregulated in certain cells, such as Th1 cells and CD8+ T cells, and it plays a role in T cell dysfunction and exhaustion [PMC8602903]. Mmu-mir-31 has also been studied in the context of obesity, but its expression was not consistently found to be downregulated [PMC6001404][PMC3742134[PMC3742134]. It has been shown to regulate the expression of various target genes involved in different biological processes [PMC3742134][PMC4077261][PMC7926522][PMC8602903][PMC3692539[PMC4077261][PMC7926522][PMC8602903][PMC3692539].
u c uaac a u A G C -U gaa gcu cug ucgga c ggagagg GGCAA AUG UGGCAUAGC Guu c ||| ||| ||||| | ||||||| ||||| ||| ||||||||| ||| cga gac agucu g ccuuuCU CCGUU UAC ACCGUAUCG caa u u c ---- - u A A A Uc gag
Accession | MIMAT0000538 |
Description | Mus musculus mmu-miR-31-5p mature miRNA |
Sequence | 28 - AGGCAAGAUGCUGGCAUAGCUG - 49 |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
Accession | MIMAT0004634 |
Description | Mus musculus mmu-miR-31-3p mature miRNA |
Sequence | 64 - UGCUAUGCCAACAUAUUGCCAUC - 86 |
Evidence |
experimental
cloned [2], Illumina [3-4] |
Database links | |
Predicted targets |
|