miRBase entry: mmu-mir-21a

Stem-loop mmu-mir-21a


Accession
MI0000569
Symbol
MGI: Mir21a
Description
Mus musculus mmu-mir-21a precursor miRNA
Gene family
MIPF0000060; mir-21

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Mmu-mir-21 is a microRNA that participates in cell differentiation by inhibiting genes related to pluripotency, such as Nanog, Sox2, and Pou5f1 [PMC9505168]. It is known as a differentiation-state-related miRNA and its highest expression is observed at E11.5 [PMC1421506]. Mmu-mir-21 has been studied in various contexts, including its role in gene regulation and its potential as a therapeutic target. In one study, the putative targets of mmu-mir-21 were aligned with upregulated genes to investigate its regulatory effects [PMC3907398]. In another study, the overexpression or inhibition of mmu-mir-21 was achieved using synthetic mimics or inhibitors [PMC4678163]. Mmu-mir-21 has also been implicated in the Lin28/let-7/Blimp1 pathway and PGC specification [PMC9563050]. Its expression levels have been quantified in serum samples of mice but no significant increases were observed [PMC5008393]. Additionally, mmu-mir-21 has been included in qPCR validation experiments along with other murine microRNAs to assess their expression levels [PMC3319598]. It has also been identified as one of the miRNAs upregulated after HFD-induced obesity and suggested as a potential research subject for future studies on obesity [PMC3319598]. Bioinformatic analysis revealed potential target hits for mmu-mir-21* and mmu-mir-21 that are not fully overlapped [PMC3329493].

Literature search
663 open access papers mention mmu-mir-21a
(6633 sentences)

Sequence

11621027 reads, 34902 reads per million, 107 experiments
uguaccaccuugucggaUAGCUUAUCAGACUGAUGUUGAcuguugaaucucauggCAACAGCAGUCGAUGGGCUGUCugacauuuugguauc
.((((((...((((((((((((((((.(((((.(((((.((((.((...))))))))))).)))))))))))))))))))))...)))))).

Structure
u      ccu                A     A     A    u  a 
 guacca   ugucggaUAGCUUAUC GACUG UGUUG cugu ga  
 ||||||   |||||||||||||||| ||||| ||||| |||| || u
 uauggu   acaguCUGUCGGGUAG CUGAC ACAAC ggua cu  
c      uuu                -     G     -    -  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr11: 86584067-86584158 [-]

Database links

Mature mmu-miR-21a-5p

Accession MIMAT0000530
Description Mus musculus mmu-miR-21a-5p mature miRNA
Sequence 18 - UAGCUUAUCAGACUGAUGUUGA - 39
Evidence experimental
cloned [1-2,4-6], Northern [2], Illumina [8]
Database links
Predicted targets

Mature mmu-miR-21a-3p

Accession MIMAT0004628
Description Mus musculus mmu-miR-21a-3p mature miRNA
Sequence 56 - CAACAGCAGUCGAUGGGCUGUC - 77
Evidence experimental
cloned [6], Illumina [8-9]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  6. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  7. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  8. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  9. PubMed ID: 17687032
    Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium
    "Sathyan P, Golden HB, Miranda RC"
    "J Neurosci (2007) 27:8546-8557