Stem-loop sequence mmu-mir-30c-2

Accession

MI0000548 (change log)

Symbol

MGI:Mir30c-2

Description

Mus musculus miR-30c-2 stem-loop

Gene family

MIPF0000005; mir-30

Literature search

212 open access papers mention mmu-mir-30c-2
(1271 sentences)

Stem-loop

      u a    uauu       u   aca         gugaaa 
5' gag g caga    guaaaca ccu   cucucagcu      a
   ||| | ||||    ||||||| |||   |||||||||       
3' uuc c gucu    cauuugu gga   gagggucga      g
      - -    cucu       c   --a         aagaau 

Deep sequencing

692452 reads, 1.96e+03 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-30c was cloned and mapped to chromosome 4 in reference [1] (MI0000547). A search of more recent mouse genome assemblies suggests the presence of a second locus encoding miR-30c on chromosome 1, represented by this entry.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr1: 23291701-23291784 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000114071 ; RP23-28L24.7-001; exon 1

  ENSMUST00000182303 ; Gm27028-001; exon 1

Database links

• EntrezGene:Mirn30c-2
• MGI:Mir30c-2
• RNAcentral:URS000075C326_10090
• miRBase Tracker:MI0000548

Mature sequence mmu-miR-30c-5p

• Accession: MIMAT0000514
• Previous IDs: mmu-miR-30c
• Sequence: 14 - uguaaacauccuacacucucagc - 36
• Deep sequencing: 1298540 reads, 107 experiments
• Evidence: experimental; cloned [1-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS000019907A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-30c-5p
  • miRDB:mmu-miR-30c-5p
  • microrna.org:mmu-miR-30c-5p

Mature sequence mmu-miR-30c-2-3p

• Accession: MIMAT0005438
• Previous IDs: mmu-miR-30c-2*
• Sequence: 54 - cugggagaaggcuguuuacucu - 75
• Deep sequencing: 43291 reads, 104 experiments
• Evidence: experimental; cloned [4], Illumina [5-6]
• Database links:
  • RNAcentral:URS0000527228_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-30c-2-3p
  • miRDB:mmu-miR-30c-2-3p
  • microrna.org:mmu-miR-30c-2-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).