![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-19b-2 |
||||||||||||||
Accession | MI0000546 (change log) | |||||||||||||
Previous IDs | mmu-mir-19b | |||||||||||||
Symbol | MGI:Mir19b-2 | |||||||||||||
Description | Mus musculus miR-19b-2 stem-loop | |||||||||||||
Gene family | MIPF0000011; mir-19 | |||||||||||||
Literature search |
![]()
124 open access papers mention mmu-mir-19b-2 | |||||||||||||
Stem-loop |
a -- guu - g 5' cuuacgauuaguuuugca gauuugca cagc guauau u |||||||||||||||||| |||||||| |||| |||||| 3' ggguguuagucaaaacgu cuaaacgu gucg uauaua g a ac --- g a |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
Mouse miR-19b was cloned from mouse tissues by independent groups [1,2]. There are two predicted hairpin precursors, with closely related human homologues [4]: mir-19b-1 (MI0000718) on chromosome 14, and mir-19b-2 (previously named mir-19b here, MI0000546) on mouse chromosome X. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence mmu-miR-19b-2-5p |
|
Accession | MIMAT0017010 |
Previous IDs | mmu-miR-19b-2* |
Sequence |
11 - aguuuugcagauuugcaguucagc - 34 |
Deep sequencing | 29 reads, 14 experiments |
Evidence | experimental; Illumina [7] |
Predicted targets |
|
Mature sequence mmu-miR-19b-3p |
|
Accession | MIMAT0000513 |
Previous IDs | mmu-miR-19b |
Sequence |
54 - ugugcaaauccaugcaaaacuga - 76 |
Deep sequencing | 736255 reads, 107 experiments |
Evidence | experimental; cloned [1-3,5], Northern [2], Illumina [6,8] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
4 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|