Stem-loop sequence ath-MIR319b

AccessionMI0000545 (change log)
DescriptionArabidopsis thaliana miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

35 open access papers mention ath-MIR319b
(270 sentences)

Stem-loop 
     a     uu          cu       uaauau    -         -ga      ac        c  aa     a    aa   u 
5' ag gagcu  cuucggucca  cauggag      guga gauuuaauu   cucucg  ucauucau ca  uacca auga  gaa u
   || |||||  ||||||||||  |||||||      |||| |||||||||   ||||||  |||||||| ||  ||||| ||||  |||  
3' uc cucga  gaagucaggu  guaucuc      cacu cugaguuaa   gagagc  aguaagua gu  auggu uacu  cuu u
     c     gg          uc       ----uu    u         aca      gu        a  aa     a    --   g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a homologue of miR319a (MI0000544) -- also called miR-JAW -- and is located on BAC MBK23.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 16660469-16660640 [-]
intergenic
Database links

Mature sequence ath-miR319b

Accession MIMAT0000512
Sequence

152 -  

uuggacugaagggagcucccu

 - 172

Get sequence
Evidence experimental; Northern [1], 5'RACE [2], cloned [2], 454 [3], Illumina [5]

References

1
PMID:12931144 "Control of leaf morphogenesis by microRNAs" Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D Nature. 425:257-263(2003).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).