![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR319b |
|||||
Accession | MI0000545 (change log) | ||||
Description | Arabidopsis thaliana miR319b stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
35 open access papers mention ath-MIR319b | ||||
Stem-loop |
a uu cu uaauau - -ga ac c aa a aa u 5' ag gagcu cuucggucca cauggag guga gauuuaauu cucucg ucauucau ca uacca auga gaa u || ||||| |||||||||| ||||||| |||| ||||||||| |||||| |||||||| || ||||| |||| ||| 3' uc cucga gaagucaggu guaucuc cacu cugaguuaa gagagc aguaagua gu auggu uacu cuu u c gg uc ----uu u aca gu a aa a -- g |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a homologue of miR319a (MI0000544) -- also called miR-JAW -- and is located on BAC MBK23. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR319b |
|
Accession | MIMAT0000512 |
Sequence |
152 - uuggacugaagggagcucccu - 172 |
Evidence | experimental; Northern [1], 5'RACE [2], cloned [2], 454 [3], Illumina [5] |
References |
|
1 |
PMID:12931144
"Control of leaf morphogenesis by microRNAs"
Nature. 425:257-263(2003).
|
2 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|