Stem-loop sequence cbr-mir-74a

Accession

MI0000513 (change log)

Previous IDs

cbr-mir-74

Description

Caenorhabditis briggsae miR-74 stem-loop

Gene family

MIPF0000275; mir-74

Stem-loop

   c    u        u    a    uc     -   ucuca 
5'  gcac uuugggcu ccau ucuu  ccagc ucc     u
    |||| |||||||| |||| ||||  ||||| |||     u
3'  cgug agaucuga ggua agaa  ggucg agg     u
   a    u        c    a    -c     u   uauca 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context

• Coordinates (CB4; GCA_000004555.3): chrX: 4426602-4426682 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from cbr-mir-74a

• cbr-mir-2231: chrX: 4430575-4430638 [-]
• cbr-mir-73a: chrX: 4426887-4426980 [-]
• cbr-mir-74b: chrX: 4426711-4426827 [-]
• cbr-mir-74a: chrX: 4426602-4426682 [-]
• cbr-mir-785b: chrX: 4421255-4421318 [+]
• cbr-mir-75: chrX: 4419739-4419830 [-]

Database links

• RNAcentral:URS000078FC19_6238
• miRBase Tracker:MI0000513

Mature sequence cbr-miR-74a

• Accession: MIMAT0000483
• Previous IDs: cbr-miR-74
• Sequence: 54 - uggcaagaaauggcagucuaga - 75
• Evidence: by similarity; MI0000045

References

1. PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).