Stem-loop sequence cbr-mir-73a

AccessionMI0000512 (change log)
Previous IDscbr-mir-73
DescriptionCaenorhabditis briggsae miR-73 stem-loop
Gene family MIPF0000276; mir-73
Stem-loop 
   c    -  -   a     c     u  -c    aa    ca  uaucu 
5'  gguc cc uca acaac gagcu cc  cguc  gcca  gc     c
    |||| || ||| ||||| ||||| ||  ||||  ||||  ||     u
3'  ccag gg agu uguug cuuga gg  guag  cggu  cg     g
   a    a  c   a     a     c  uu    aa    --  uuaca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4426887-4426980 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-73a
cbr-mir-2231chrX: 4430575-4430638 [-]
cbr-mir-73achrX: 4426887-4426980 [-]
cbr-mir-74bchrX: 4426711-4426827 [-]
cbr-mir-74achrX: 4426602-4426682 [-]
cbr-mir-785bchrX: 4421255-4421318 [+]
cbr-mir-75chrX: 4419739-4419830 [-]
Database links

Mature sequence cbr-miR-73a

Accession MIMAT0000482
Previous IDscbr-miR-73
Sequence

56 -  

uggcaagauguuggcaguucagu

 - 78

Get sequence
Evidence by similarity; MI0000044

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).