![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-146a |
|||||
Accession | MI0000477 (change log) | ||||
Previous IDs | hsa-mir-146 | ||||
Symbol | HGNC:MIR146A | ||||
Description | Homo sapiens miR-146a stem-loop | ||||
Gene family | MIPF0000103; mir-146 | ||||
Literature search |
![]()
749 open access papers mention hsa-mir-146a | ||||
Stem-loop |
c -----u u uu c u g uc 5' cgaug guaucc cagcu gagaacugaauu ca ggguu ug a ||||| |||||| ||||| |||||||||||| || ||||| || g 3' gcuac uauagg gucga uucuugacuuaa gu uccag ac u u ugucuc - -c a c - ug |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-146a-5p |
|
Accession | MIMAT0000449 |
Previous IDs | hsa-miR-146;hsa-miR-146a |
Sequence |
21 - ugagaacugaauuccauggguu - 42 |
Deep sequencing | 1354966 reads, 160 experiments |
Evidence | experimental; cloned [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-146a-3p |
|
Accession | MIMAT0004608 |
Previous IDs | hsa-miR-146a* |
Sequence |
57 - ccucugaaauucaguucuucag - 78 |
Deep sequencing | 599 reads, 79 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15800047
"Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
Proc Natl Acad Sci U S A. 102:5570-5575(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|