miRBase entry: hsa-mir-9-2

Stem-loop hsa-mir-9-2


Accession
MI0000467
Symbol
HGNC: MIR9-2
Description
Homo sapiens hsa-mir-9-2 precursor miRNA
Gene family
MIPF0000014; mir-9

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR9-2 is a gene belonging to the mir-9 family, which is involved in neurogenesis [PMC6723948]. In a study investigating the methylation status of mir9-1, MIR9-2, and MIR9-3 promoters in tumors and normal margins, the researchers explored the possible correlation with clinopathological features [PMC5019297]. One of the polymorphisms investigated was rs4916723, located downstream of the MIR9-2 gene and previously associated with ADHD [PMC6723948]. The MIR9-2 gene is encoded on the same strand as three splice forms of LINC00461 and knockdown of LINC00461 significantly reduced mir-9 expression levels, suggesting a relationship between these genes and providing a potential link between rs4916723 and MIR9-2 [PMC6723948]. MiR-9-5p is the major transcript from genes MIR9-1, MIR9-2, and MIR9-3 located on chromosomes 1, 5, and 15 [PMC6162741]. The regulation of MIR9-2 was found to involve a relevant motif in a specific region on chromosome 5 [PMC5366901]. Additionally, Tbr2 and Tbr1 were found to directly repress MIR9-2 (encoding miR-*), as shown in studies on non-coding RNA (ncRNA) [PMC6113890].

Literature search
539 open access papers mention hsa-mir-9-2
(3355 sentences)

Sequence

663540 reads, 2776 reads per million, 111 experiments
ggaagcgaguuguuaUCUUUGGUUAUCUAGCUGUAUGAguguauuggucuucAUAAAGCUAGAUAACCGAAAGUaaaaacuccuuca
.((((.(((((.((((.(((((((((((((((.((((((.(.......))))))).))))))))))))))).)))).))))))))).

Structure
g    c     g    C               G      u ua 
 gaag gaguu uuaU UUUGGUUAUCUAGCU UAUGAg g  u
 |||| ||||| |||| ||||||||||||||| |||||| |  u
 cuuc cucaa aaUG AAGCCAAUAGAUCGA AUAcuu c  g
a    -     a    A               A      - ug 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 88666853-88666939 [-]

Disease association
hsa-mir-9-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-9-5p

Accession MIMAT0000441
Description Homo sapiens hsa-miR-9-5p mature miRNA
Sequence 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-9-3p

Accession MIMAT0000442
Description Homo sapiens hsa-miR-9-3p mature miRNA
Sequence 53 - AUAAAGCUAGAUAACCGAAAGU - 74
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739