Stem-loop sequence hsa-mir-124-2

Accession

MI0000444 (change log)

Previous IDs

hsa-mir-124a-2

Symbol

HGNC:MIR124-2

Description

Homo sapiens miR-124-2 stem-loop

Gene family

MIPF0000021; mir-124

Literature search

428 open access papers mention hsa-mir-124-2
(3634 sentences)

Stem-loop

   a     au   ----            cc        a   ga        uaau 
5'  ucaag  uag    aggcucugcucu  guguucac gcg  ccuugauu    g
    |||||  |||    ||||||||||||  |||||||| |||  ||||||||    u
3'  aguuc  guc    uccgaggcgaga  cguaagug cgc  ggaauuaa    c
   a     ac   ggca            ac        g   ac        caua 

Deep sequencing

132843 reads, 248 reads per million, 109 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 64379149-64379257 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000378596 ; RP11-45K10.2-001; intron 1

  ENST00000518739 ; RP11-45K10.2-001; intron 1

  antisense

  OTTHUMT00000378592 ; CTD-3046C4.1-003; intron 1

  OTTHUMT00000378593 ; CTD-3046C4.1-005; intron 1

  OTTHUMT00000378594 ; CTD-3046C4.1-004; intron 1

  ENST00000522265 ; CTD-3046C4.1-003; intron 1

  ENST00000521061 ; CTD-3046C4.1-005; intron 1

  ENST00000522086 ; CTD-3046C4.1-004; intron 1

Database links

• EntrezGene:MIR124-2
• HGNC:MIR124-2
• RNAcentral:URS000023AB58_9606
• miRBase Tracker:MI0000444

Mature sequence hsa-miR-124-5p

• Accession: MIMAT0004591
• Previous IDs: hsa-miR-124*
• Sequence: 25 - cguguucacagcggaccuugau - 46
• Deep sequencing: 4370 reads, 22 experiments
• Evidence: experimental; cloned [5]
• Predicted targets:
  • TargetMiner:hsa-miR-124-5p
  • TargetScanVert:hsa-miR-124-5p
  • miRDB:hsa-miR-124-5p
  • microrna.org:hsa-miR-124-5p

Mature sequence hsa-miR-124-3p

• Accession: MIMAT0000422
• Previous IDs: hsa-miR-124a;hsa-miR-124
• Sequence: 62 - uaaggcacgcggugaaugccaa - 83
• Deep sequencing: 393261 reads, 104 experiments
• Evidence: experimental; cloned [2,4-5]
• Database links:
  • RNAcentral:URS000020BE6A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-124-3p
  • TargetScanVert:hsa-miR-124-3p.1
  • miRDB:hsa-miR-124-3p
  • microrna.org:hsa-miR-124-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).