Stem-loop sequence hsa-mir-1-2

AccessionMI0000437 (change log)
Previous IDshsa-mir-1d
Symbol HGNC:MIR1-2
DescriptionHomo sapiens miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

520 open access papers mention hsa-mir-1-2
(2604 sentences)

Stem-loop 
   a      c                     ac     ugaaca 
5'  ccuacu agaguacauacuucuuuaugu  ccaua      u
    |||||| |||||||||||||||||||||  |||||       
3'  ggaugg uuuuauguaugaagaaaugua  gguau      a
   c      u                     -a     cguaac
Get sequence
Deep sequencing
11518588 reads, 1.33e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MI0000651, mouse MI0000139), and mir-1-2 (human MI0000437, mouse MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 21829004-21829088 [-]
sense
OTTHUMT00000254903 ; OSBPL1A-002; intron 1
OTTHUMT00000446405 ; OSBPL1A-015; intron 1
OTTHUMT00000446434 ; OSBPL1A-016; intron 1
OTTHUMT00000446357 ; OSBPL1A-003; intron 3
OTTHUMT00000446406 ; OSBPL1A-014; intron 4
OTTHUMT00000254902 ; OSBPL1A-001; intron 15
ENST00000399443 ; OSBPL1A-002; intron 1
ENST00000578055 ; OSBPL1A-015; intron 1
ENST00000585247 ; OSBPL1A-016; intron 1
ENST00000357041 ; OSBPL1A-003; intron 3
ENST00000584119 ; OSBPL1A-014; intron 4
ENST00000319481 ; OSBPL1A-001; intron 15
Clustered miRNAs
< 10kb from hsa-mir-1-2
hsa-mir-1-2chr18: 21829004-21829088 [-]
hsa-mir-133a-1chr18: 21825698-21825785 [-]
Database links

Mature sequence hsa-miR-1-3p

Accession MIMAT0000416
Previous IDshsa-miR-1
Sequence

53 -  

uggaauguaaagaaguauguau

 - 74

Get sequence
Deep sequencing21440115 reads, 159 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).