miRBase entry: hsa-mir-1-2

Stem-loop hsa-mir-1-2


Accession
MI0000437
Symbol
HGNC: MIR1-2
Description
Homo sapiens hsa-mir-1-2 precursor miRNA
Gene family
MIPF0000038; mir-1

Literature search
520 open access papers mention hsa-mir-1-2
(2664 sentences)

Sequence

6897451 reads, 5211 reads per million, 153 experiments
accuacucagaguacauacuucuuuauguacccauaugaacauacaaugcuaUGGAAUGUAAAGAAGUAUGUAUuuuugguaggc
.((((((.(((((((((((((((((((((..(((((..(........)..))))).))))))))))))))))))))).)))))).

Structure
a      c                     ac     ug aca 
 ccuacu agaguacauacuucuuuaugu  ccaua  a   u
 |||||| |||||||||||||||||||||  |||||  |    
 ggaugg uuuUAUGUAUGAAGAAAUGUA  GGUau  u   a
c      u                     -A     cg aac 


Annotation confidence High
Do you think this miRNA is real?
Comments
Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr18: 21829004-21829088 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-1-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-1-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1-3p

Accession MIMAT0000416
Description Homo sapiens hsa-miR-1-3p mature miRNA
Sequence 53 - UGGAAUGUAAAGAAGUAUGUAU - 74
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739