![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-2c |
||||||||
Accession | MI0000431 (change log) | |||||||
Description | Drosophila melanogaster miR-2c stem-loop | |||||||
Gene family | MIPF0000049; mir-2 | |||||||
Literature search |
![]()
28 open access papers mention dme-mir-2c | |||||||
Stem-loop |
au c u - aag aagaaagauauuucu 5' ucgu cuua uu caauguc aucaaa ggcug g |||| |||| || ||||||| |||||| ||||| 3' agcg gagu aa guuacgg uaguuu ccgac c ac - c g cga acuaugcuaaguuua |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
miR-2c was predicted by similarity to miR-2a (MI0000117). Expression in Drosophila was independently confirmed by Northern blot analysis [1] and by cloning [2]. The latter study confirmed the ends of the excised miR. Stark et al. [3] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence dme-miR-2c-5p |
|
Accession | MIMAT0020845 |
Sequence |
20 - ucaucaaaaagggcugaagaaagau - 44 |
Deep sequencing | 6936 reads, 45 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-2c-3p |
|
Accession | MIMAT0000411 |
Previous IDs | dme-miR-2c |
Sequence |
63 - uaucacagccagcuuugaugggc - 85 |
Deep sequencing | 918005 reads, 49 experiments |
Evidence | experimental; Northern [1], cloned [2], 454 [4-5], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
3 |
PMID:14691535
"Identification of Drosophila MicroRNA targets"
PLoS Biol. 1:E60(2003).
|
4 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
5 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|