Stem-loop sequence dme-mir-2c

Accession

MI0000431 (change log)

Description

Drosophila melanogaster miR-2c stem-loop

Gene family

MIPF0000049; mir-2

Literature search

28 open access papers mention dme-mir-2c
(103 sentences)

Stem-loop

       au    c  u       -      aag     aagaaagauauuucu 
5' ucgu  cuua uu caauguc aucaaa   ggcug               g
   ||||  |||| || ||||||| ||||||   |||||                
3' agcg  gagu aa guuacgg uaguuu   ccgac               c
       ac    -  c       g      cga     acuaugcuaaguuua 

Deep sequencing

924946 reads, 1.67e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-2c was predicted by similarity to miR-2a (MI0000117). Expression in Drosophila was independently confirmed by Northern blot analysis [1] and by cloning [2]. The latter study confirmed the ends of the excised miR. Stark et al. [3] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3R: 15417744-15417845 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dme-mir-2c

• dme-mir-2c: chr3R: 15417744-15417845 [-]
• dme-mir-13a: chr3R: 15417542-15417616 [-]
• dme-mir-13b-1: chr3R: 15417408-15417475 [-]

Database links

• RNAcentral:URS00003BF393_7227
• miRBase Tracker:MI0000431

Mature sequence dme-miR-2c-5p

• Accession: MIMAT0020845
• Sequence: 20 - ucaucaaaaagggcugaagaaagau - 44
• Deep sequencing: 6936 reads, 45 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00001ECE7B_7227

Mature sequence dme-miR-2c-3p

• Accession: MIMAT0000411
• Previous IDs: dme-miR-2c
• Sequence: 63 - uaucacagccagcuuugaugggc - 85
• Deep sequencing: 918005 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS00001EB815_7227
• Predicted targets:
  • TargetScanFly:dme-miR-2c
  • microrna.org:dme-miR-2c-3p

References

1. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).