Stem-loop sequence dme-mir-315

Accession

MI0000427 (change log)

Description

Drosophila melanogaster miR-315 stem-loop

Gene family

MIPF0000141; mir-315

Literature search

5 open access papers mention dme-mir-315
(10 sentences)

Stem-loop

          auaa   ug          a       cuc    u 
5' cacuuau    uuu  auuguugcuc gaaagcc   auug u
   |||||||    |||  |||||||||| |||||||   |||| u
3' gugaaua    aaa  uaauaacgag cuuucgg   ugac a
          gacc   gu          -       --u    c 

Deep sequencing

297446 reads, 3.7e+03 reads per million, 46 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Lai et al. predicted this sequence based on conservation in D. pseudoobscura, but did not verify expression [2]. Aravin et al. describe identification and mapping of the ends of the excised sequence by cloning [1].

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3L: 18860971-18861054 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS0000497540_7227
• miRBase Tracker:MI0000427

Mature sequence dme-miR-315-5p

• Accession: MIMAT0000407
• Previous IDs: dme-miR-315
• Sequence: 12 - uuuugauuguugcucagaaagc - 33
• Deep sequencing: 295294 reads, 46 experiments
• Evidence: experimental; cloned [1], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS0000490BC9_7227
• Predicted targets:
  • TargetScanFly:dme-miR-315
  • microrna.org:dme-miR-315-5p

Mature sequence dme-miR-315-3p

• Accession: MIMAT0020841
• Sequence: 54 - cuuucgagcaauaauugaaacc - 75
• Deep sequencing: 2149 reads, 41 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000566581_7227

References

1. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).