![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-306 |
||||||||||
Accession | MI0000414 (change log) | |||||||||
Description | Drosophila melanogaster miR-306 stem-loop | |||||||||
Gene family | MIPF0000313; mir-306 | |||||||||
Literature search |
![]()
5 open access papers mention dme-mir-306 | |||||||||
Stem-loop |
-g c au u uu -- - u 5' uccacu g ggc cagguac agugacucuca aug c u |||||| | ||| ||||||| ||||||||||| ||| | 3' ggguga c ucg guccgug ucacugggggu uac g u ca - cg u uc uu a u |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Comments |
miR-306 was identified and ends mapped by cloning. Reference [1] also identified a less predominantly expressed miR from the opposite arm of the precursor, designated miR-306* here |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence dme-miR-306-5p |
|
Accession | MIMAT0000393 |
Previous IDs | dme-miR-306 |
Sequence |
15 - ucagguacuuagugacucucaa - 36 |
Deep sequencing | 448965 reads, 49 experiments |
Evidence | experimental; cloned [1], 454 [2-3], Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence dme-miR-306-3p |
|
Accession | MIMAT0000394 |
Previous IDs | dme-miR-306* |
Sequence |
52 - gggggucacucugugccugugc - 73 |
Deep sequencing | 10779 reads, 49 experiments |
Evidence | experimental; cloned [1], 454 [2-3], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|