Stem-loop sequence dme-mir-31b

Accession

MI0000410 (change log)

Description

Drosophila melanogaster miR-31b stem-loop

Gene family

MIPF0000064; mir-31

Literature search

6 open access papers mention dme-mir-31b
(10 sentences)

Stem-loop

       -     aau     a     uc  a       agagcacagcggaucgaacauuuuauc 
5' caaa uaaug   uuggc agaug  gg auagcug                           g
   |||| |||||   ||||| |||||  || |||||||                           u
3' guuu auuac   aacug ucuac  cc uaucggc                           c
       c     guu     a     -u  g       gaaaaguuuuuauuaguguaaaaaagc 

Deep sequencing

1404420 reads, 7.91e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Release_6; GCA_000001215.4): chrX: 8993305-8993431 [-]
• Overlapping transcripts:

  sense

  FBtr0332279 ; CR43836-RA; intron 2

  FBtr0332280 ; CR43836-RB; intron 2

  FBtr0332281 ; CR43836-RC; intron 2

  antisense

  FBtr0333602 ; rdgA-RI; intron 1

  FBtr0333601 ; rdgA-RH; intron 1

  FBtr0302660 ; rdgA-RA; intron 1

  FBtr0302665 ; rdgA-RG; intron 1

  FBtr0302661 ; rdgA-RB; intron 2

  FBtr0302663 ; rdgA-RD; intron 3

  FBtr0302664 ; rdgA-RE; intron 3

Database links

• RNAcentral:URS000024E35C_7227
• miRBase Tracker:MI0000410

Mature sequence dme-miR-31b-5p

• Accession: MIMAT0000389
• Previous IDs: dme-miR-31b
• Sequence: 14 - uggcaagaugucggaauagcug - 35
• Deep sequencing: 1403459 reads, 49 experiments
• Evidence: experimental; cloned [1], 454 [2-3], Illumina [3]
• Database links:
  • RNAcentral:URS00003B790D_7227
• Predicted targets:
  • TargetScanFly:dme-miR-31b
  • microrna.org:dme-miR-31b-5p

Mature sequence dme-miR-31b-3p

• Accession: MIMAT0020825
• Sequence: 94 - ggcuaugccucaucuagucaau - 115
• Deep sequencing: 893 reads, 21 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000050CBCC_7227

References

1. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).