![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-302a |
||||||||||||
Accession | MI0000402 (change log) | |||||||||||
Previous IDs | mmu-mir-302 | |||||||||||
Symbol | MGI:Mir302a | |||||||||||
Description | Mus musculus miR-302a stem-loop | |||||||||||
Gene family | MIPF0000071; mir-302 | |||||||||||
Literature search |
![]()
85 open access papers mention mmu-mir-302a | |||||||||||
Stem-loop |
c u uu aga 5' cca cacu aaacgugg guacuugcuuu c ||| |||| |||||||| ||||||||||| c 3' ggu gugg uuuguacc cgugaaugaaa u a u uu gaa |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence mmu-miR-302a-5p |
|
Accession | MIMAT0004579 |
Previous IDs | mmu-miR-302a* |
Sequence |
6 - acuuaaacgugguuguacuugc - 27 |
Deep sequencing | 320 reads, 14 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-302a-3p |
|
Accession | MIMAT0000380 |
Previous IDs | mmu-miR-302;mmu-miR-302a |
Sequence |
44 - uaagugcuuccauguuuugguga - 66 |
Deep sequencing | 4184 reads, 20 experiments |
Evidence | experimental; cloned [1-2], Northern [1], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|