Stem-loop sequence mmu-mir-301a

Accession

MI0000401 (change log)

Previous IDs

mmu-mir-301

Description

Mus musculus miR-301a stem-loop

Gene family

MIPF0000034; mir-130

Literature search

51 open access papers mention mmu-mir-301a
(647 sentences)

Stem-loop

         aa   c    c    ---u          ----a       
5' ccugcu  cgg ugcu ugac    uuauugcacu     cuguac 
   ||||||  ||| |||| ||||    ||||||||||     ||||| u
3' ggacga  gcc acga acug    gauaacguga     gacauu 
         gc   u    a    uuau          cgagc       

Deep sequencing

182330 reads, 879 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 87113004-87113089 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000002440 ; Ska2-001; intron 1

  OTTMUST00000067491 ; Ska2-003; intron 1

  ENSMUST00000020794 ; Ska2-001; intron 1

  ENSMUST00000142263 ; Ska2-003; intron 1

Database links

• EntrezGene:Mirn301
• RNAcentral:URS000075CB59_10090
• miRBase Tracker:MI0000401

Mature sequence mmu-miR-301a-5p

• Accession: MIMAT0017008
• Previous IDs: mmu-miR-301a*
• Sequence: 14 - gcucugacuuuauugcacuacu - 35
• Deep sequencing: 5860 reads, 96 experiments
• Evidence: experimental; 454 [5], Illumina [6]
• Database links:
  • RNAcentral:URS000020C95B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-301a-5p
  • miRDB:mmu-miR-301a-5p

Mature sequence mmu-miR-301a-3p

• Accession: MIMAT0000379
• Previous IDs: mmu-miR-301;mmu-miR-301a
• Sequence: 51 - cagugcaauaguauugucaaagc - 73
• Deep sequencing: 176467 reads, 107 experiments
• Evidence: experimental; cloned [1-3], Northern [1], Illumina [4,6]
• Database links:
  • RNAcentral:URS00001C11BC_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-301a-3p
  • miRDB:mmu-miR-301a-3p
  • microrna.org:mmu-miR-301a-3p

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).