Stem-loop sequence mmu-mir-292a

Accession

MI0000390 (change log)

Previous IDs

mmu-mir-292

Description

Mus musculus miR-292 stem-loop

Gene family

MIPF0000068; mir-290

Literature search

16 open access papers mention mmu-mir-292a
(143 sentences)

Stem-loop

        u           --a    g   u    ugga     a 
5' cagcc gugauacucaa   cugg ggc cuuu    uuuuc u
   ||||| |||||||||||   |||| ||| ||||    |||||  
3' guugg cacugugaguu   gacc ccg gaaa    agaag c
        c           uug    g   u    ----     g 

Deep sequencing

57738 reads, 492 reads per million, 52 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr7: 3219189-3219270 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-292a

• mmu-mir-290a: chr7: 3218626-3218708 [+]
• mmu-mir-290b: chr7: 3218638-3218695 [-]
• mmu-mir-291a: chr7: 3218919-3219000 [+]
• mmu-mir-292a: chr7: 3219189-3219270 [+]
• mmu-mir-292b: chr7: 3219198-3219259 [-]
• mmu-mir-291b: chr7: 3219482-3219560 [+]
• mmu-mir-293: chr7: 3220343-3220422 [+]
• mmu-mir-294: chr7: 3220641-3220724 [+]
• mmu-mir-295: chr7: 3220773-3220841 [+]

Database links

• EntrezGene:Mirn292
• RNAcentral:URS000075EC12_10090
• miRBase Tracker:MI0000390

Mature sequence mmu-miR-292a-5p

• Accession: MIMAT0000369
• Previous IDs: mmu-miR-292-5p
• Sequence: 12 - acucaaacugggggcucuuuug - 33
• Deep sequencing: 13305 reads, 43 experiments
• Evidence: experimental; cloned [1-2], Northern [1], Illumina [3-4]
• Database links:
  • RNAcentral:URS0000506FB9_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-292a-5p
  • miRDB:mmu-miR-292a-5p
  • microrna.org:mmu-miR-292a-5p

Mature sequence mmu-miR-292a-3p

• Accession: MIMAT0000370
• Previous IDs: mmu-miR-292-3p
• Sequence: 50 - aaagugccgccagguuuugagugu - 73
• Deep sequencing: 44425 reads, 45 experiments
• Evidence: experimental; cloned [1-2], Northern [1], Illumina [3-4]
• Database links:
  • RNAcentral:URS00002FCA7A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-292a-3p
  • miRDB:mmu-miR-292a-3p
  • microrna.org:mmu-miR-292a-3p

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).