Stem-loop sequence dme-mir-286

Accession

MI0000380 (change log)

Description

Drosophila melanogaster miR-286 stem-loop

Gene family

MIPF0000225; mir-286

Literature search

8 open access papers mention dme-mir-286
(27 sentences)

Stem-loop

   ---         aaug    a   -    a     ucuuuuucaaagaaag 
5'    uuaaaauug    gcga ugu cggu ugguc                g
      |||||||||    |||| ||| |||| |||||                 
3'    aauuuuaau    ugcu aca gcca aucag                u
   uaa         aucg    c   a    g     ugaagcgaauuagcuu 

Deep sequencing

132240 reads, 4.43e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-286 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 22-24 nt with 23 nt the most commonly expressed.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2R: 19661422-19661521 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dme-mir-286

• dme-mir-309: chr2R: 19661706-19661774 [-]
• dme-mir-3: chr2R: 19661595-19661663 [-]
• dme-mir-286: chr2R: 19661422-19661521 [-]
• dme-mir-4: chr2R: 19661289-19661369 [-]
• dme-mir-5: chr2R: 19661158-19661226 [-]
• dme-mir-6-1: chr2R: 19661003-19661084 [-]
• dme-mir-6-2: chr2R: 19660869-19660942 [-]
• dme-mir-6-3: chr2R: 19660716-19660795 [-]

Database links

• RNAcentral:URS0000673E2E_7227
• miRBase Tracker:MI0000380

Mature sequence dme-miR-286-5p

• Accession: MIMAT0020820
• Sequence: 13 - ggcgaaugucgguauggucucu - 34
• Deep sequencing: 13242 reads, 34 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000035C452_7227

Mature sequence dme-miR-286-3p

• Accession: MIMAT0000359
• Previous IDs: dme-miR-286
• Sequence: 65 - ugacuagaccgaacacucgugcu - 87
• Deep sequencing: 118983 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS000042B23A_7227
• Predicted targets:
  • TargetScanFly:dme-miR-286
  • microrna.org:dme-miR-286-3p

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).