Stem-loop sequence dme-mir-210

Accession

MI0000376 (change log)

Description

Drosophila melanogaster miR-210 stem-loop

Gene family

MIPF0000086; mir-210

Literature search

8 open access papers mention dme-mir-210
(29 sentences)

Stem-loop

   ------------aaa   -g     ugc        gc   -         uuaga 
5'                ggu  cuuau   agcugcug  cac ugcacaaga     c
                  |||  |||||   ||||||||  ||| |||||||||     u
3'                ccg  gaaug   ucggcgac  gug gcguguucu     u
   ccgacaacgaagaua   ga     uua        -a   u         cagaa 

Deep sequencing

287197 reads, 2.54e+03 reads per million, 48 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chrX: 18128219-18128318 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dme-mir-210

• dme-mir-969: chrX: 18124357-18124450 [+]
• dme-mir-210: chrX: 18128219-18128318 [+]

Database links

• RNAcentral:URS00003A0D76_7227
• miRBase Tracker:MI0000376

Mature sequence dme-miR-210-5p

• Accession: MIMAT0020816
• Sequence: 16 - agcugcuggccacugcacaagau - 38
• Deep sequencing: 5397 reads, 43 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000175A05_7227

Mature sequence dme-miR-210-3p

• Accession: MIMAT0000355
• Previous IDs: dme-miR-210
• Sequence: 52 - cuugugcgugugacagcggcuau - 74
• Deep sequencing: 281799 reads, 47 experiments
• Evidence: experimental; cloned [2], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS0000306AB9_7227
• Predicted targets:
  • microrna.org:dme-miR-210-3p

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).